Information de reference pour ce titreAccession Number: | 00007529-199808140-00025.
|
Author: | Aladjem, Mirit I.; Rodewald, Luo Wei; Kolman, John L.; Wahl, Geoffrey M.
|
Institution: | Gene Expression Laboratory, The Salk Institute, San Diego, CA 92037, USA. (Wahl) To whom correspondence should be addressed at Gene Expression Laboratory, The Salk Institute, 100 10 North Torrey Pines Road, San Diego, CA 92037, USA.
|
Title: | Genetic Dissection of a Mammalian Replicator in the Human [small beta, Greek]-Globin Locus.[Report]
|
Source: | Science. 281(5379):1005-1009, August 14, 1998.
|
Abstract: | The timing and localization of DNA replication initiation in mammalian cells are heritable traits, but it is not known whether initiation requires specific DNA sequences.A site-specific recombination strategy was used to show that DNA sequences previously identified as replication initiation sites could initiate replication when transferred to new chromosomal locations. An 8-kilobase DNA sequence encompassing the origin of DNA replication in the human [small beta, Greek]-globin locus initiated replication in the simian genome. Specific deletions within the globin origin did not initiate replication in these chromosomal sites. These data suggest that initiation of DNA replication in mammalian cells requires specific sequence information and extend the replicon hypothesis to higher eukaryotes.
Copyright (C) 1998 by the American Association for the Advancement of Science
|
References: | 1. A. Almasan, S. Linke, T. Paulson, L. Huang, G. Wahl, Cancer Metastasis Rev. 14, 59 (1995); K. A. Nasmyth, Science 274, 1643 (1996).
2. F. Jacob, J. Brenner, F. Cuzin, Cold Spring Harbor Symp. Quant. Biol. 288, 329 (1964).
3. D. Bramhill and A. Kornberg, Cell 54, 915 (1988).
4. M. D. Challberg and T. J. Kelly, Annu. Rev. Biochem. 58, 671 (1989).
5. S. P. Bell, Y. Marahrens, H. Rao, B. Stillman, Cold Spring Harbor Symp. Quant. Biol. 58, 435 (1993).
6. R. K. Clyne and T. J. Kelly, Methods 13, 221 (1997).
7. S. Handeli, A. Klar, M. Meuth, H. Cedar, Cell 57, 909 (1989); W. C. Burhans, L. T. Vassilev, M. S. Caddle, N. H. Heintz, M. L. DePamphilis, ibid. 62, 955 (1990); S. M. Carroll et al., Mol. Cell. Biol. 13, 2971 (1993); G. H. Nonet and G. M. Wahl, Somatic Cell Mol. Genet. 19, 171 (1993); R. E. Kelly, M. L. DeRose, B. W. Draper, G. M. Wahl, Mol. Cell. Biol. 15, 4136 (1995); W. C. Burhans and J. A. Huberman, Science 263, 639 (1994).
8. N. Shimizu, T. Kanda, G. M. Wahl, Nature Genet. 12, 65 (1996); N. Shimizu, N. Itoh, H. Utiyama, G. M. Wahl, J. Cell Biol. 140, 1307 (1998); R. Snapka and A. Varshavsky, Proc. Natl. Acad. Sci. U.S.A. 80, 7533 (1983).
9. D. Coverley and R. Laskey, Annu. Rev. Biochem. 63, 745 (1994); J. J. Blow, J. Cell Biol. 122, 993 (1993); J. F. Diffley, Genes Dev. 10, 2819 (1996).
10. R. M. Harland and R. A. D. Laskey, Cell 21, 761 (1980); M. Gilbert, H. Miyazawa, M. L. DePamphilis, Mol. Cell Biol. 15, 2942 (1995); P. Pasero, D. Braguglia, S. M. Gasser, Genes Dev. 11, 1504 (1997).
11. M. I. Aladjern et al., Science 270, 815 (1995).
12. B. J. Brewer and W. L. Fangman, ibid. 262, 1728 (1993).
13. S. O'Gorman, D. T. Fox, G. M. Wahl, ibid. 251, 1351 (1991); B. Sauer and N. Henderson, New Biol. 2, 441 (1990); M. I. Aladjem, L. L. Brody, S. O'Gorman, G. M. Wahl, Mol. Cell. Biol. 17, 857 (1997).
14. D. Kitsberg, S. Selig, I. Keshet, H. Cedar, Nature 366, 588 (1993).
15. The nascent strand abundance assay was performed as described [Y. Yoon, J. A. Sanchez, C. Brun, J. A. Huberman, Mol. Cell. Biol. 15, 2482 (1995)] with the modifications described by M. I. Aladjem et al. [Science 270, 815 (1995)]. Briefly, nascent strands were isolated as short DNA fragments (<8 kb) that incorporated bromodeoxyuridine (BrdU) during a 90-min pulse label. Short BrdU-substituted strands, isolated by density gradient centrifugation, were further fractionated by alkaline agarose gel electrophoresis. Fragments of various sizes were isolated from the gel and amplified with primers spanning the region of interest. PCR primers used were as follows: (1) Upper: AAATCTAACAGCCAAGTCAAAT; lower: AATAAAATAAAACAATAAAATG; (2) (hBG) upper: CCTGAGGAGAAGTCTGCCGT; lower: CAGTGCAGCTCACTCAGTGT; (3) (ivs) upper: GGAAGGGGAGAAGTAACAGGGT; lower: AAGGGCCTAGCTTGGACTCAG; (4) upper: TATTAGCATAGTGTTACCATCA; lower: TTCTTTATTTTTCCTTTTGTTG; (5) upper: ATCCAAAAACTAAATCTCACA; lower: CACCCGTCTTCTGCGTCACTC; (6) ([small beta, Greek]-Gal) upper: TTGAAAATGGTCTGCTGCTGCTGAAC; lower: CGGATAAACGGAACTGGAAAAACTGC; mitochondrial DNA, upper: TACGCTCTATTCTCGACACTCACAACAAAG; lower: GGTTTAAGAATAATGGGGGTAGTATGTAAG.
16. M. I. Aladjem, L. W. Rodewald, J. L. Kolman, G. M. Wahl, data not shown.
17. E. Epner, W. C. Forrester, M. Groudine, Proc. Natl. Acad. Sci. U.S.A. 85, 8081 (1988).
18. V. Dhar, A. I. Skoultchi, C. L. Schildkraut, Mol. Cell. Biol. 9, 3524 (1989).
19. R. S. Hansen, T. K. Canfield, M. M. Lamb, S. M. Gartler, C. D. Laird, Cell 73, 1403 (1993).
20. PCR reaction that compared various preparations of DNAs included two controls. First, the amount of DNA in each one of the samples was normalized by the use of mitochondrial primers [ [15] (S. Strehl, J. M. LaSalle, M. Lalande, Mol. Cell Biol. 17, 6157 (1997)]. Then, the efficiency of the amplification reaction in each reaction was normalized by the use of mimic competitors as described [C. Pelizon, S. Diviacco, A. Falaschi, M. Giacca, ibid. 16, 5358 (1996)]. Each competitor contains the same sequence as the expected fragment amplified from genomic DNA but is larger by 20 to 70 bp and serves as a standard to compare the abundance of genomic amplified DNA in the S phase fractions. The results of one set of experiments are shown in Figure 2B, but the experiment was repeated twice with essentially the same results.
21. D. D. Dubey, S.-M. Kim, I. T. Todorov, J. A. Huberman, Curr. Biol. 6, 467 (1997); J. F. Theis and C. S. Newlon, Mol. Cell. Biol. 14, 7652 (1994).
22. Y. Marahrens and B. Stillman, Science 255, 817 (1992).
23. M. L. DePamphilis, Curr. Opin. Cell. Biol. 5, 434 (1993); T. Kobayashi, T. Rein, M. L. DePamphilis, Mol. Cell. Biol. 18, 3266 (1998).
24. A. K. Bielinsky and S. A. Gerbi, ibid. 279, 95 (1998).
25. S. S. Heinzel, P. J. Krysan, C. T. Tran, M. P. Calos, Mol. Cell. Biol. 11, 2263 (1991).
26. B. Stillman, Science 274, 1659 (1996).
27. D. Coverley and R. Laskey, Annu. Rev. Biochem. 63, 745 (1994); J. J. Blow, J. Cell. Biol. 122, 993 (1993); J. F. Diffley, Genes Dev. 10, 2819 (1996).
28. E. Epner et al., Proc. Natl. Acad. Sci. U.S.A. 88, 153 (1991); F. Grosveld et al., Cold Spring Harbor Symp. Quant. Biol. 58, 7 (1993).
29. J. L. Hamlin and P. A. Dijkwel, Curr. Opin. Genet. Dev. 5, 153 (1995).
30. J. L. Hamlin, personal communication.
31. W. Forrester, C. Thompson, J. Elder, M. Groudine, Proc. Natl. Acad. Sci. U.S.A. 83, 1359 (1986).
32. M. C. Walters et al., Genes Dev. 10, 185 (1996).
33. A. Kornberg and T. A. Baker, DNA Replication (Freeman, New York, 1992).
34. J. J. Li and T. J. Kelly, Mol. Cell. Biol. 5, 1238 (1985); M. L. DePamphilis, Annu. Rev. Biochem. 62, 29 (1993); B. Stillman, Cell 78, 725 (1994).
35. J. F. Diffley, Genes Dev. 10, 2819 (1996).
36. R. S. Williams, R. V. Shohet, B. Stillman, Proc. Natl. Acad. Sci. U.S.A. 94, 142 (1997).
37. D. T. Pak et al., Cell 91, 311 (1997); A. Rowles et al., ibid. 87, 287 (1996); M. Ishiai et al., Genomics 46, 294 (1997).
38. C. S. Newlon, Cell 91, 717 (1997).
39. J. F. Diffley, J. H. Cocker, S. J. Dowell, J. Harwood, A. Rowley, J. Cell Sci. Suppl. 19, 67 (1995).
40. Y. Yoon, J. A. Sanchez, C. Brun, J. A. Huberman, Mol. Cell. Biol. 15, 2482 (1995).
41. All PCR reactions were performed in 25 [micro sign]l with an initial denaturation of 2 min at 94[degree sign]C, 35 cycles of 45 s denaturation at 94[degree sign]C, 45 s annealing at 60[degree sign]C, and 45 s extension at 72[degree sign]C. Final extension (7 min) was performed at 72[degree sign]C. All the reactions were performed with Taq polymerase (Boehringer Mannheim), and the salt conditions were optimized for each primer pair with the Invitrogen PCR optimizer kit. Competitor concentrations were determined by reading the absorbency of the cloned fragments at 260 nm. Because the transferred IR was inserted in simian cells, all the primer pairs were assayed for selective amplification of human, but not simian, DNA before use in this assay. PCR reactions with primers only, or with genomic or competitor DNA with no primers, yielded no product.
42. S. Strehl, J. M. LaSalle, M. Lalande, Mol. Cell Biol. 17, 6157 (1997).
43. C. Pelizon, S. Diviacco, A. Falaschi, M. Glacca, ibid. 16, 5358 (1996).
44. We thank E. Epner and M. Groudine for advice regarding the globin locus and for globin sequences and probes; S. Strehl and M. Lalande for sharing the sequence of mitochondrial primers; S. O'Gorman for advice and site-specific recombination reagents; J. Hamlin and M. DePamphilis for sharing data before publication and for insightful comments; J. A. Huberman, M. Mechali, S. Menut, R. Gellibolian, and F. E. Indig for comments on the manuscript; and L. Brody, A. Telling, C. Navarro, and S. Wilson for technical assistance. This work was supported by grants from the NIH (CA48405, GM51104) and the G. Harold and Leila Y. Mathers Charitable Foundation. M.I.A. was supported by a postdoctoral fellowship from the Human Frontiers Science Project Organization and by a special fellowship from the Leukemia Society of America.
|
Language: | English.
|
Document Type: | Research: Reports.
|
Journal Subset: | Life Sciences. Physical Science & Engineering.
|
ISSN: | 0036-8075
|
NLM Journal Code: | 0404511, uj7
|
Annotation(s) | |
|
|